circad | circRNAs associated with diseases

circPPP1R12A
Gene	PPP1R12A	Organism	Human
Genome Locus		Build	hg19
Disease	Colon Cancer	ICD-10	Malignant neoplasm of rectosigmoid junction (C19)
DBLink		PMID	30925892
Experimental Method
Sample Type	Tissue and cell lines	Comparison	A total of 20 paired human CC and adjacent non-tumor tissues
Method for Estimation	Quantitative PCR	PCR Details	Detailed Experimental Procedure
Primers (Experimented)	Forward ACAGCAGCAGGCTAGAAAAG Reverse TGTCCTAAGCAGGAAAAACA	Statistics	Fold Change : Upregulated pvalue : <0.05
Citation
Zheng, X, Chen, L, Zhou, Y, Wang, Q, Zheng, Z, Xu, B, Wu, C, Zhou, Q, Hu, W, Wu, C, Jiang, J (2019). A novel protein encoded by a circular RNA circPPP1R12A promotes tumor pathogenesis and metastasis of colon cancer via Hippo-YAP signaling. Mol. Cancer, 18, 1:47.